Conservation of predicted recursive splice sites in D. melanogaster and D. pseudoobscura.

Anaylsis was limited to experimentally verified sites or predicted sites with scores >= 80 and a consensus branch point.

Burnette JM, Miyamoto-Sato E, Schaub MA, Conklin J, Lopez AJ. (2005). Subdivision of large introns in Drosophila by recursive splicing at nonexonic elements. Genetics 170(2):661-74.

Key to Table

Top line = D. melanogaster

Bottom line = D. pseudoobscura

* Length estimated due to contig gap or exon not sequenced.

** Region in contig gap or not sequenced.

CE = Cassette Exon. AT = Alternative 3' Exon.

Gene Name Intron Number Intron Length (nt) RP Location RP Sequence RP Score Notes
shaggy 2 27,819
35,128
3,282
6,496
CAUUUUCUUUCCAGGUAAGUUG
CCCUCUCUUUUCAGGUAAGUUG
89
80
 
     
 
19,246
26,585
UCUUCUAUUUGUAGGUAAGUGU
UUCUCUCUUUCUAGGUAAGUUU
84
83
 
dunce 1 68,049
76,042
41,686
53,047
UCUUAUCUUUUCAGGUAAGUUG
UUUUCUCAUUUCAGGUGAGUGU
89
86
 
  4 74,355
95,939
7,335
8,370
UUCCUUUCUUCCAGGUGAGUUC
UGAUUUCUUUGCAGGUGAGUUU
85
85
 
     
 
39,145
51,453
UUUUUUCUUUACAGGUAAGUCG
UUUCUUUUUUACAGGUGAGUGU
94
91
 
     
 
46,914
 
UUUUCUCUUUACAGGUAAGUCG
**
91  
Fasciclin 2 2 48,434
50,383
12,460
15,430
UUUUCUCCUUCCAGGUAAGUGU
UCUCUUUCUUUCAGGUAAGUGU
92
90
 
     
 
21,491
27,102
UGUUUCUUUUGCAGGUACGUGC
CAAACUCUUUGCAGGUAUGUGU
83
70
 
CG9650 1 24,616
25,476
16,968
14,917
CUCUCUAUUUCCAGGUGAGUUG
UCUUUUCUUUGCAGGUGAGUUC
79
89
 
cut 1 36,241
39,282
12,322
9,646
UUCUUCUUUUACAGGUAUGUUU
UUAUUUAAUUGCAGGUAUGUGA
86
79
 
retinal degeneration A 3 12,711
15,649
1,729
1,490
UCUUUUACUUGCAGGUACGUAA
GCGUUCUUUUGCAGGUACGUAA
85
76
 
alpha Mannosidase I 1 44,374 
56,637*
19,145
27,637
UCUUUUACUUUCAGGUGAGUUG
ACGUUUACUUUCAGGUGAGUAG
88
80
 
     
 
38,717
 
AUUUCCCAUUGCAGGUGAGUUA
**
83  
CG32666 2 56,477 
55,868*
14,049
15,259
UUGUUUACUUGCAGGUAAGAGA
GUUUGUUUUUACAGGUAAAAGA
81
69
 
Displaced by 407 nt
     
 
28,617
35,089
UUCUUUUUUUACAGGUAAGCUU
CUCUUUCUUUACAGGUAAGAUA
87
81
 
Tenascin accessory 1 43,564 
*
19,273
 
CUCUUCUCUUUCAGGUAUGUAU
**
83  
multiple edematous wings 3 31,505 
*
17,391
 
UUCGUCUUUUUCAGGUAUGUAC
Not Found
80 CE
 
flotillin 2 2 83,206
90,862
20,183
23,609
CUUUGUAUUUACAGGUGAGUGA
UAUCUCCCUUACAGGUGAGUGG
83
84
 
     
 
44,665
53,414
AUCUUUCAUUACAGGUAAGCUU
UUCUUUCAUUACAGGUUAGUUC
79
81
 
bazooka 1 27,800
34,579
14,155
14,156
UUAUCUACUUGCAGGUAAGAUA
UUAUUUACUUUUAGGUAAGAGC
80
76
 
CG32560 3 24,955
25,476
14,569
14,913
UCCACUACUUACAGGUGAGUAC
UUUACUAUUUGCAGGUGAGUAC
78
86
 
Shaker 1 85,738
88,031
21,172
18,961
UUUUCUAAUUUCAGGUGAGUAA
UCUUCUCUUUGCAGGUGAGUUA
88
86
 
Beadex 1 31,271
33,843
12,402
12,696
CCUUGUUUUUCCAGGUAAGUGU
CUCUCUCUUUCCAGGUAAGUGU
85
83
 
CG32521 1 69,242
50,019
42,614
48,584
UUAUCUCGUUGCAGGUGAGUUU
UAUCUCGUUCGCAGGUGAGUGU
82
78
 
split ends 2 20,759
58,995
12,360
34,817
UUUUUUAUUUAUAGGUGCGUAU
UUUGUAUUUUCCAGGUGCGUAU
82
80
 
dachsous 2 48,486
45,184
21,937
17,839
AUCUUUUAUUUCAGGUAAGUCC
CUCUAUCUUUACAGGUAAGCCA
84
75
 
leak 1 22,651
28,406
15,042
19,031
UCUUCUCUUUCUAGGUAAGCAA
CUCUUUCGUUUUAGGUAAGGAA
79
71
 
CG14351 2 43,700
54,529
11,083
16,026
UUCUUUCUUUCUAGGUAAGCGA
UUCUGUCUUUCCAGGUAUGUCA
77
76
 
CG31666 2 36,280
47,867
5,984
10,686
UUUUUUUUUUGCAGGUAAGCAC
UUUCUCUCAUUGAGGUAAGCGA
91
70
 
     
 
25,033
35,881
CUUUUUACUUACAGGUAACUAU
CCUUCUACUUACAGGUAACUAA
84
76
 
lilliputian 2 54,113
81,376
16,160
23,343
CUUUUUCUUUGCAGGUGAGUCA
UUGUUUCUUUACAGGUGAGUCA
87
85
 
     
 
33,998
54,327
UCUUUUCUUUGCAGGUGAGUUC
UUUUCUCUGUGCAGGUGAGUUG
89
82
 
echinoid 2 41,744 
60,511*
13,686
1,800
CCAUUUCAUUUUAGGUAAGUUA
UCGUCUCUUUUUAGGUAAGUCU
78
77
 
     
 
23,485
35,887
CUUCUCGUUUGCAGGUAAGCUU
CUCUCUCUUUGCAGGUAAGCAA
81
78
 
CG15630 1 55,183
64,166
28,137
32,385
UUUGUCUCCUGCAGGUACGUAC
UUUGUCUCCUGCAGGUACGUAC
80
80
 
thickveins 2 19,718
28,350
11,761
16,858
UCUUUUCAUUUCAGGUAAGUGU
UUCUUUUGUUUCAGGUAAGUUU
90
89
 
Rapgap1 1 27,676
36,611
13,204
17,213
UUUUUUCUUUGCAGGUUAGUAC
UUUGCUCUUUGCAGGUUAGUAA
90
82
 
CG32982 9 27,192
29,642
21,289
22,804
CUUUCUCUUUCCAGGUGAGUUG
UUGUGUAUUUUCAGGUGAGUUU
85
82
 
Sema-1a 3 66,730
74,678
25,081
30,036
UCUAUUUCUUUUAGGUAAGCUG
AUUUUUCAUUGCAGGUAAGCUU
77
83
 
taiman 2 42,178 
43,798*
10,630
13,580
UCUUCUCAUUGCAGGUAUGUAU
AUUUUUCCUUUCAGGUAUGUAA
82
85
 
     
 
22,651
 
UUCUUUCUUUGCAGGUAAGCAA
**
86  
Nicotinic Acetylcholine Receptor 30D 2 43,779
44,937
14,654
14,284
UCUUUUACUUACAGGUAAGUGC
UCUUUUACUUACAGGUAAGUGC
86
90
 
CG31721 2 73,579
63,076
9,940
10,144
UCUCUCUUUUUCAGGUAUGUUA
CCUCUCUUUUUCAGGUACGUUA
84
79
 
     
 
59,953
50,684
AUUUUUUAUUGCAGGUAUGUUA
UUCUUUCGUUGCAGGUACGUUC
83
78
 
CG31757 3 72,912
73,659
53,296
51,794
UCAUUUCAUUGCAGGUAAGUCA
UCGUUUCAUUGCAGGUAAGUCA
85
82
 
bunched 3 59,108 
81,354*
16,099
22,706
UCUUUUAUUUUCAGGUAAGCAA
UCUUUUAUUUGCAGGUAAGCAA
87
87
 
     
 
29,604
42,371
CUCUUUUUUUUCAGGUAUGUAU
UCUUUUAUUUACAGGUAUGUUG
83
84
 
  4 18,891 
22,355*
8,698
92,816
UCUUCUCUUUGCAGGUAAGCAA
UCUUCUCUUUGCAGGUAAGCAA
84
84
 
kuzbanian 3 50,959
75,692
19,369
26,655
UCUUCUCUUUACAGGUGAGUGC
UUCUCUCUUUACAGGUGAGUGC
85
83
 
     
 
35,424
50,998
UUUAUUUUUUUCAGGUAAUUUG
UUUUUUUUUUCUAGGUAAGAUC
83
83
 
centaurin gamma 1A 1 54,867
54,495
35,642
34,859
UUUCUUUCUUUCAGGUAAGCUC
CUUCUUUUUUGCAGGUAAGCAU
86
85
 
outspread 1 52,318 
135,892*
32,099
**
UGUUCUCGUUUCAGGUAUGUAC
CGUUCUCGUUUCAGGUAUGUAC
80
73
 
  2 24,165
33,591
9,025
12,987
UUCUUUUCUUUCAGGUGAGUUA
UUCUUUUCUUUCAGGUGAGUUA
89
89
 
CG15138 2 54,422
66,268
25,036
34,024
UCUUUGUUUUUCAGGUAAGUCG
CUUUGUCUUUUCAGGUAAGUCG
88
84
 
Cadherin-N 11 39,923
39,303
20,500
 
AUUCAUUCUUUCAGGUAUGUAA
Not Found
81  
Fasciclin 3 2 62,671 
79,755*
27,005
35,443
UCUUUUCGUUACAGGUAUGUAU
UCUUUUAUUUACAGGUAAGUUU
84
94
 
Furin 1 1 40,500 
*
32,589
**
UUCUCUCUUUGCAGGUAAGCCA
UUUUCUCUUUAAAGGUAAGCCA
79
76
 
complexin 3 10,713
14,327
1,603
2,786
UCUUUUAUUUACAGGUAAGCGU
UCUUAAAUUUUCAGGUAAGCGU
86
79
 
prickle 1 57,449
46,193
23,935
25,044
UUUUCUCGUUACAGGUAAGUUG
CGCUCUCAUUCCAGGUAAGUUG
88
76
 
pipsqueak 3 48,359
37,351
18,137
17,373
CUUUCUCUUUGCAGGUAAGCCA
CUUUCUCUUUGCAGGUAAGCGC
80
80
 
frazzled 1 26,746
29,065
11,999
 
AUUCUCCUUUGCAGGUGAGUGC
Not Found
84  
faint sausage 3 51,980
43,655
17,914
16,204
UGUUCUCUUUCUAGGUAAGUGC
CUCUCUCUUUGCAGGUAAGAAA
81
78
 
     
 
32,224
 
UUUCUUCUUUGCAGGUAAGUUC
Not Found
92  
mastermind 2 27,528
27,509
14,399
11,627
UUCUCUCGUUGCAGGUGAGUUU
CUCUCUCGUUGCAGGUGAGUUC
81
76
 
muscleblind 2 75,030 
78,889*
19,772
 
UCUUCUUUUUUCAGGUAUGUAC
**
84 AT
 
     
 
29,924
 
CUAUCUAUUUUCAGGUAAGUUU
Not Found
86  
 
     
 
40,012
 
UCUAUUCUUUGCAGGUGAGUGU
CUCUCUCGUUGCAGGUAUGUUU
86
72
 
Displaced by 150 nt
     
 
56,513
 
UCUUCUAUUUCCAGGUAAAUUU
CUCUCUCGUUACAGGUAAGACA
81
71
 
serrano 4 41,483
39,504
25,056
24,360
CUAUCUAUUUGCAGGUAAGUCU
UUGUUUCUUUUCAGGUAAGUGC
83
88
 
smooth 10 27,461
21,898
13,737
 
UACUCUCUUUGUAGGUAAGUUU
Not Found
80  
     
 
18,272
19,080
UACUCUCUUUGUAGGUAAGUUU
UUUUCUCAUUUUAGGUAAGUUU
80
85
 
  11 26,555 
25,932*
12,139
13,228**
CCCACUCACUACAGGUAAUUCC
ACUGAUCUUACCAGGUAAGUCC
90
71
 
  12 35,791
38,847
27,944
29,392
UUUUGUCUUUUCAGGUAAGUCG
CUUCUUACUUGCAGGUAAGUCG
88
85
CE
CE
Epidermal growth factor receptor 6 31,587
29,697
10,561
10,694
UUCCAUCUUUGCAGGUGAGUUC
UCUUCUCGUUGCAGGUGAGUUU
81
83
 
CG13499 2 32,123
 
16,515
 
UCUAUUUCUUACAGGUAACUAU
**
83  
plexus 2 35,108
36,387
28,168
29,403
UUUGUUUCUUGCAGGUGAGUGU
UCUGUCUCUUUCAGGUGAGUUU
88
86
 
nahoda 1 7,675 
*
469
 
UUCUCCUCCUUCAGGUGAGUUC
Not Found
81  
bric a brac 1 1 58,746 
19,845*
19,429
8,900
CUUUAUCGUUACAGGUAAGUUC
UUGUUUCGUUGCAGGUAAGUGU
85
85
 
CG32296 1 36,790
43,527
27,937
31,876
UUGUAUCUUUGCAGGUGAGUUU
CUUCUUUUUUGCAGGUAAGUUC
84
90
 
Ecdysone-induced protein 63E 1 35,958
49,915
16,984
24,496
AUUUUUUAUUCCAGGUAAGUUC
AAUUUUCGUUUCAGGUAAGUUC
90
84
 
CG32264 1 30,479
34,473
6,382
6,953
CUCUUCUCUUGCAGGUAAGUUU
UAUCUCUUUUGCAGGUAAGUCU
89
89
 
  4 43,264
57,184
28,501
36,409
UCUUUAUUUUCCAGGUGAGUUU
UGUUCCCUUUCAGGGUGAGUUU
89
64
 
Cip4 2 23,912
23,028
10,909
10,077
UCUUUCUCUUGCAGGUAAGUUG
UCUUUGUUUUCCAGGUAAGUUU
93
90
 
Guanine nucleotide exchange fa 2 25,221 
29,034*
14,909
**
CUUUUUCGUUUCAGGUUAGUAG
UGGUUUGUUUUCAGGUUAGUAG
82
77
 
CG32423 3 48,508
64,272
25,135
33,465
CUAUUUUUUUGCAGGUAAGUUU
UAUCUUUUUUGCAGGUAAGUUU
90
91
 
still life 2 29,976
30,629
8,585
9,398
UUUUGCCAUUGCAGGUAAGCUA
UUUUUCCUUUGCAGGUAAGCAU
81
90
 
CG18769 3 28,185
30,035
19,058
20,916
UCUUUUAUUUACAGGUGAGUUG
UACUCCAUUUGCAGGUGAGUUA
89
80
 
PAR-domain protein 1 1 49,017
53,599
28,368
31,107
GGUUUUCUUUAUAGGUGAGUAA
UUCUCUAUUUGCAGGUGAGUUU
79
84
 
     
 
38,529
42,170
UCUUUUAUUUACAGGUAAGCAU
UAUUUCAUUUCCAGGUAAGCUU
88
86
 
nemo 3 58,071 
43,488*
13,908
**
UUCUCUCUUUUUAGGUAAGUUC
CUUUCUCGUUUUAGGUAAGUUU
82
80
 
CG32062 2 49,822
59,953
1,306
1,371
UCUUUUCUUUGCAGGUACGUUU
UCUUUUCGUUGCAGGUACGUUU
86
81
 
     
 
16,525
18,781
CUUUUUCAUUACAGGUAAGUUU
CUUUUUCAUUACAGGUAAGUUG
91
89
 
     
 
29,693
34,731
UCUUCUAUUUGCAGGUACGUCU
UUUACAUUUUGCAGGUACGUCU
80
78
 
     
 
35,916
43,243
UCUAUUUCUUUCAGGUAUGUUU
UGCCUUUCUUUCAGGUAUGUCC
84
74
 
division abnormally delayed 1 48,657
64,794
6,535
9,301
UUCUCCAUUUGCAGGUGCGUAU
UCCUCCGUUUGCAGGUGUGUAU
78
73
 
Mob1 2 34,551
32,968
7,776
7,177
UGUUUUCCUUUCAGGUGAGUGU
CUCCUCUCUUUCAGGUGAGUAA
87
83
 
rolling pebbles 2 32,102
28,493
14,600
12,889
CUUUUUCUUUCCAGGUAAGUUU
UUUUCUACUUUUAGGUAAGUCU
93
85
 
bruno-3 1 41,973
42,615
19,171
16,423
UUGUUUCUUUCCAGGUAAGUGA
UUCUUUACUUACAGGUAAGUGA
89
89
 
  3 25,853
28,695
12,823
14,086
GUCUGUCUUUGCAGGUAAGUUG
AUGUGUCUUUCCAGGUAAGUUG
80
80
CE
CE
  6 54,245
60,371
22,117
24,979
CUCUCUCUUUUCAGGUAAGUUC
CUCUCUCUUUCCAGGUAAGUUC
84
83
 
nuclear fallout 6 16,972
17,363
3,619
4,147
UCCUUUAUUUCCAGGUAAGCAA
GGCCCUCUUUUUAGGUAUUUAC
82
53
 
frizzled 1 29,170
28,678
14,666
14,921
UCUGUUUCUUUUAGGUAAGUCU
UCUGUCUAUUGCAGGUACGUGU
83
78
 
  4 49,409
49,125
14,623
15,368
UCCUCUUCUUUCAGGUAUGUAC
UUUCCAUCUUUCAGGUAUGUAA
78
81
AT
AT
     
 
28,780
30,354
UCUUUUCAUUUCAGGUAUGUAA
UCUUGUCGUUGCAGGUAUGUUA
84
76
 
dally-like 1 30,913
27,594
11,303
8,762
UGCUCUCAUUACAGGUAAGUUC
GCUUUCUUUUGCAGGUAAGUAC
81
89
 
CG33158 3 62,790 
71,309*
25,794
29,116
UUUUCUCAUUUCAGGUAAGUCC
UCUUUUCAUUUCAGGUGAGUCU
88
86
 
Ecdysone-induced protein 75B 1 65,240
51,717
24,527
10,901
UCCUUUUCUUGCAGGUAUGUAC
CCGUCUCGUUACAGGUAUGUAC
82
69
 
     
 
36,566
22,495
UAUUCUACUUUCAGGUAAGUCA
GUUUUUCAUUUCAGGUAAGUCA
87
86
 
     
 
42,710
 
UCUUUCCAUUCCAGGUGAGUGA
Not Found
86  
  2 23,400
20,043
7,157
 
UCUUUCCAUUGCAGGUAAGCUU
Not Found
84  
CG6896 2 34,325
39,889
25,878
30,025
UCUCUUUAUUUCAGGUAUGUUA
UUCUUUCUUUUUAGGUAAGAUG
81
78
 
Displaced by 103 nt
naked cuticle 1 33,245
33,636
18,669
19,149
UCUUUUCCUUGCAGGUGUGUAC
CCGUUUCCUUGCAGGUGUGUAC
82
73
 
CG32223 2 21,594
18,173
7,989
7,083
UAUUUUUAUUCCAGGUAAUUAC
CUGUUUUAUUUCAGGUAACUCC
82
72
 
CG6014 1 28,445
32,034
9,248
10,158
AUUUCCCUUUGCAGGUAAGUUC
UCUUUUCAUUGCAGGUAAACGC
88
72
 
Tenascin major 1 66,250 
*
7,162
8,180
UUCUUCUAUUACAGGUGAGUAA
AAUUUCCUUUUCAGGUGAGUAA
88
87
 
     
 
25,811
 
UCUUCUGCUUUCAGGUAUGUAA
**
81  
CG33202 1 26,006
26,076
3,233
2,911
UCUCUCCUUUUUAGGUAAGCAU
UCUCUCUUUUUUAGGUAAAGCA
80
66
 
polychaetoid 1 49,376
48,266
33,402
26,266
UUUUUUCGUUGCAGGUAUGUAU
UUUUUUUUCCUCAGGUAUGUAU
86
82
 
pumilio 8 132,738
167,793
12,869
20,816
AUUUUUUUUUGCAGGUGAGUUU
UCCUUUCCUUGCAGGUGAGUUG
91
83
 
     
 
72,429
96,908
CUUUUUCUUUGCAGGUAGGUGA
CUUUCUCGUUGCAGGUAGGUGA
83
75
 
     
 
82,343
108,500
UCUUUUCUUUGCAGGUAAGUUU
UUGUUUCUUUGCAGGUGAGUUU
94
87
 
     
 
92,336
119,826
UCCUUUUCUUUCAGGUAAGUUC
CGUUUUCGUUUCAGGUAAGUUU
89
84
 
     
 
101,802
130,083
UCUUCUCAUUGUAGGUAAGUCC
UCUUCUCAUUCUAGGUAAGUCC
79
79
 
     
 
115,024
146,460
UUUUCUCUUUACAGGUAAGUGA
UUUGCUAUUUCCAGGUAAGUGA
92
86
CE
CE
     
 
121,443
153,576
UUCUCUCUUUUUAGGUAAGUUU
CGCUCUCUUUUUAGGUAAGUUC
84
74
 
pasilla 1 12,203
13,623
11,171
12,721
UCUUUCCAUUUCAGGUGAGUCA
CUUUGCCAUUUCAGGUGAGUCA
85
79
CE
CE
CG31363 1 25,937
25,932
2,634
2,343
UUCUCUUUUUGCAGGUAAGUUC
CCGUCUCUCUCCAGGUAUGUUU
88
69
 
CG3563 1 45,465
61,786
21,620
27,334
UUCUUUUUUUGCAGGUGAGUUC
UUUCACUUUUGCAGGUGAGUUC
89
86
 
Ultrabithorax 3 73,651
74,606
7,391
7,363
GCUUGCAUUUUCAGGUAAGAUA
GGUUGCAUUUUCAGGUAACAUA
74
63
CE
CE
     
 
22,113
22,620
UCUAUUUUUUCCAGGUAAGAGA
UUUCUGUUUUCCAGGUAAGAGA
82
81
CE
CE
     
 
48,191
50,108
CUUCUCUUUUCUAGGUAAGUGU
UUCUCUUCUUUUAGGUAAGUGU
85
83
 
couch potato 2 28,892
40,167
21,789
30,648
UUUUAUCUUUGCAGGUGAGCUA
CUCUUUUUUUACAGGUGAGUUU
83
87
 
fruitless 9 79,261
79,937
51,695
53,645
UUCUACUUUUCUAGGUAAGUCC
UUCUAUAUUUCUAGGUAAGUUU
81
82
 
dystrophin 22 47,738
66,468
20,452
26,803
UAUUUCUCUUGCAGGUAUGUAC
AUUAUUUUUUUCAGGUAUGUAA
86
84
 
Displaced by 488 nt
     
 
31,528
41,617
CUUUUUCAUUGCAGGUAAGCGU
UUUUUUCAUUGCAGGUAAGCGU
82
85
 
CG5060 1 36,093 
39,458*
21,438
20,674
UCCUUAUUUUUCAGGUAUGUAC
UUUUGUUUUUUCAGGUACGAUU
80
77
 
CG31176 1 44,598
56,573
15,862
20,930
CUUUUCUAUUACAGGUAUGUAC
UCUGUUCCUUUCAGGUAUGUAC
84
80
 
 
held out wings 2 19,345
24,645
10,543
12,984
UCGUUUACUUGCAGGUGAGUUU
UUGUUUAUUUGCAGGUGAGUUU
84
87
 
CG31163 3 24,509 
32,424*
10,471
14,722
UUUAUUCGUUCUAGGUGAGUUU
CUCUCUCUUUUUAGGUAAGUUU
80
80
 
  4 103,624 
83,076*
22,848
31,965
AUUUCUCGUUUCAGGUAAGUUG
CUUUUUCGUUUCAGGUAAGUUC
84
87
 
     
 
44,774
57,680
UCUUUUAAUUGCAGGUAAGCUC
UCUUCUAAUUGCAGGUAAGCUC
82
79
 
     
 
57,913
 
UCUUCUACUUCCAGGUAAGCUG
**
81  
klingon 2 33,040 
16,714*
20,858
9,005
UUAUUUAUUUGCAGGUGAGUUC
UUAUUUAUUUGCAGGUAAGUCC
88
88
 
Pellino 2 23,401
30,766
6,495
5,337
CUCUUCUUUUGCAGGUAAGUUU
AUUUUUUUUUGCAGGUAAGUUU
89
94
 
Nicotinic Acetylcholine Receptor alpha-96Aa 2 29,990
31,873
16,785
18,147
UUCUUUGCUUGCAGGUGAGUUG
UUGUUUUCUUGCAGGUGAGUCA
85
85
 
musashi 2 44,350
58,387
41,961
55,623
UUUCUUUCUUUCAGGUAAGCAA
UUCUUUCAUUUCAGGUAAGCGA
88
80
 
  4 20,151
25,808
9,297
12,595
UGUUUACUUUCCAGGUAAGUUC
UGUUUACUUUGCAGGUAAGUUC
88
88
 
Transcript 48 2 25,252
36,977
13,821
17,594
UUUCUCUCUUGCAGGUAAAUAA
UCUUUUCAUUGCAGGUAAACGA
86
72
 
Displaced by 265 nt
Toll 1 27,095
28,877
6,863
6,904
CUAUAUAUUUGCAGGUAAGCAG
UUUUUGUUACGCAGGUAAGCAU
78
76
 
kayak 1 17,571
20,516
7,870
9,880
CUCUCUCGUUGCAGGUAAGUAG
CUCUCUCGUUGCAGGUAAGUAG
80
80
 
headcase 1 28,904
33,264
9,756
11,796
ACAUUUCUUUGCAGGUAAGUGA
CGCUCUCUUUGCAGGUAAGUAA
84
81
 
  2 49,001
43,136
21,448
13,621
UCGUUUCGUUGCAGGUGAGUUU
CUCUCUCGUUGCAGGUGAGUUU
81
77
 
sanpodo 2 38,301
41,567
18,842
19,478
CAUUCUCUUUGCAGGUAAGCAA
UCUCUUUUUUGCAGGUAAGCAA
80
85
 
hephaestus 3 16,320
 
9,738
 
UCUUCUGCUUUCAGGUAAGUUU
**
88 CE
 
  4 77,163
 
49,726
**
CGAUUUAUUUACAGGUGAGUUA
CGAUUUAUUUACAGGUGAGUUA
81
80
 
klarsicht 1 25,193
33,285
10,524
14,118
UUCUUUCUUUACAGGUGAGUUG
CUUUUGCUUUUUAGGUGAGUGG
88
77
 
  5 43,328
56,481
12,833
17,639
UCUUCUCGUUUCAGGUAAGCAA
CCGUCUAUUUCCAGGUAAGCAA
80
74
 
     
 
33,187
41,541
UCUUCUCUUUCUAGGUAAGAAU
UCCUCUCUUUGCAGGUAAGUAU
79
87
 
CG40120 3 22,899 
*
7,349
 
UUUUGUUUUUGCAGGUCAGUCU
**
83  
CG12567 1 11,354 
*
352
 
CUUUUACCUUUCAGGUAAGAAA
**
84  

* = Estimated due to contig gap or exon not sequenced. ** = Region in contig gap or not sequenced.CE = Cassette Exon. AT = Alternative 3' Exon.